View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6957_low_9 (Length: 248)
Name: NF6957_low_9
Description: NF6957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6957_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 37293195 - 37292976
Alignment:
| Q |
17 |
ttggtggtagtgtaaacaatgagaactccccaagtaatgaagctcatagttcttatgttatgcaatcatctttactgtctgtgcaagaggaatcccaact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37293195 |
ttggtggtagtgtaaacaatgagaactccccaagtaatgaagctcatagttcttatgttatgcaatcatctttactgtctgtgcaagaggaatcccaact |
37293096 |
T |
|
| Q |
117 |
tacttcagcagcaatctcacccgatgagatgtacaactttgtcttttcgcctgttgatgaagagatggtgggagacccttcttacttggttgctataatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37293095 |
tacttcagcagcaatctcacccgatgagatgtacaactttgtcttttcgcctgttgatgaagagatggtgggagacccttcttacttggttgctataatt |
37292996 |
T |
|
| Q |
217 |
attgagtttcttcacaggtt |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37292995 |
attgagtttcttcacaggtt |
37292976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 221
Target Start/End: Complemental strand, 48306585 - 48306535
Alignment:
| Q |
170 |
ttgatgaagagatggtgggagacccttcttacttggttgctataattattga |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| ||||||| |||| |
|
|
| T |
48306585 |
ttgatgaagagatggtgggaaacccttcttactt-gttgatataattgttga |
48306535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University