View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6958_high_5 (Length: 261)
Name: NF6958_high_5
Description: NF6958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6958_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 31934704 - 31934544
Alignment:
| Q |
1 |
atagacacattttagaaggatcaaagatacttgattgaaaggagagaatctaaaatataaaattcgtttcactagttatccgtgaattttgaatagcaga |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||| | |||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
31934704 |
atagatacattttagaaggatcagagatacttgattgaaaggagagaatcaaaaatgtgaaattcgtttgactagttatcggtgaattttgaatagcaga |
31934605 |
T |
|
| Q |
101 |
ttgaactggtcttaatttcttctttgttatgaataaatcttattttcttaacttcttttta |
161 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31934604 |
ttaaactggtcttaatttcttctttgttaagaataaatcttattttcttaacttcttttta |
31934544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 31934519 - 31934478
Alignment:
| Q |
206 |
acatcttacatcccgatcaccgtggattctaatattaaattt |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31934519 |
acatcttacatcccgaccaccgtggattctaatattaaattt |
31934478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University