View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6958_low_1 (Length: 396)

Name: NF6958_low_1
Description: NF6958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6958_low_1
NF6958_low_1
[»] chr3 (3 HSPs)
chr3 (89-212)||(25620998-25621122)
chr3 (97-165)||(25624918-25624986)
chr3 (258-298)||(25636448-25636488)


Alignment Details
Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 89 - 212
Target Start/End: Complemental strand, 25621122 - 25620998
Alignment:
89 aaaaatgtagaaattagcttaaaaatcataatacgtatgaggacaatattacaagtgtcattcaatagatgcctctttcagtagaaaaaatgagccg-ta 187  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||    
25621122 aaaaatgtagaaattagcttaaaaatcatcatacgtatgaggacaatattacaagtgtcattcaatagatgcctctttcagtagaaacaatgagccgata 25621023  T
188 ctgcgtataggaaatagcaagttat 212  Q
    |||| ||||||||||||||||||||    
25621022 ctgcttataggaaatagcaagttat 25620998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 97 - 165
Target Start/End: Complemental strand, 25624986 - 25624918
Alignment:
97 agaaattagcttaaaaatcataatacgtatgaggacaatattacaagtgtcattcaatagatgcctctt 165  Q
    ||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||    
25624986 agaaattaggttaaatatcataatacgtatgaggacaaaattacaagtgtcattcaatagatgcctctt 25624918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 258 - 298
Target Start/End: Complemental strand, 25636488 - 25636448
Alignment:
258 gttctagaatatgactaaaagcaacagtgatttgattgtca 298  Q
    |||||||||||||||||||||||||||||||||||||||||    
25636488 gttctagaatatgactaaaagcaacagtgatttgattgtca 25636448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University