View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6958_low_1 (Length: 396)
Name: NF6958_low_1
Description: NF6958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6958_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 89 - 212
Target Start/End: Complemental strand, 25621122 - 25620998
Alignment:
| Q |
89 |
aaaaatgtagaaattagcttaaaaatcataatacgtatgaggacaatattacaagtgtcattcaatagatgcctctttcagtagaaaaaatgagccg-ta |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
25621122 |
aaaaatgtagaaattagcttaaaaatcatcatacgtatgaggacaatattacaagtgtcattcaatagatgcctctttcagtagaaacaatgagccgata |
25621023 |
T |
|
| Q |
188 |
ctgcgtataggaaatagcaagttat |
212 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
25621022 |
ctgcttataggaaatagcaagttat |
25620998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 97 - 165
Target Start/End: Complemental strand, 25624986 - 25624918
Alignment:
| Q |
97 |
agaaattagcttaaaaatcataatacgtatgaggacaatattacaagtgtcattcaatagatgcctctt |
165 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25624986 |
agaaattaggttaaatatcataatacgtatgaggacaaaattacaagtgtcattcaatagatgcctctt |
25624918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 258 - 298
Target Start/End: Complemental strand, 25636488 - 25636448
Alignment:
| Q |
258 |
gttctagaatatgactaaaagcaacagtgatttgattgtca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25636488 |
gttctagaatatgactaaaagcaacagtgatttgattgtca |
25636448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University