View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6958_low_11 (Length: 203)
Name: NF6958_low_11
Description: NF6958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6958_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 2756915 - 2756773
Alignment:
| Q |
17 |
aagttccacaactagtttgaggaaaaaccatagaagaaatcatgannnnnnnngtgtgtggaagagttcagagtgtgttctataagatattgttgttaca |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2756915 |
aagttccacaactagtttgagggaaaaccatagaagaaatcgtgattatttttgtgtgtggaagagttcagagtgtgttctataagatattgttgttaca |
2756816 |
T |
 |
| Q |
117 |
tagtattgctagtgtttttaaggctacaagtgtgatattaatg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2756815 |
tagtattgctagtgtttttaaggctacaagtgtgatattaatg |
2756773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University