View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6959_high_16 (Length: 221)
Name: NF6959_high_16
Description: NF6959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6959_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 38197174 - 38197386
Alignment:
| Q |
1 |
catacaatatgtaggaatggactgtgcaactgatttaattaacacttctcttcctgctttggataaatgcttactcgaccattgttgtattttcctccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38197174 |
catacaatatgtaggaatggactgtgcaactgatttaattaacacttctcttcctgctttggataaatgcttacccgaccattgttgtattttcctccaa |
38197273 |
T |
|
| Q |
101 |
actttgtctctcagatatccaaaaattgctttcttgttacgcgccccaccatggatggcatgcccaaatacttcctgtttcccataccttccgacacttg |
200 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38197274 |
actatgtctctcagatatccaaaaattgatttcttgttacgcgccccaccatggatggcatgcccaaatacttcctgtttcccataccttccgacacttg |
38197373 |
T |
|
| Q |
201 |
aaggatattcttc |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38197374 |
aaggatattcttc |
38197386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 5 - 95
Target Start/End: Complemental strand, 25499539 - 25499449
Alignment:
| Q |
5 |
caatatgtaggaatggactgtgcaactgatttaattaacacttctcttcctgctttggataaatgcttactcgaccattgttgtattttcc |
95 |
Q |
| |
|
|||||||| ||||| || ||||| |||||||| || || || |||||||||||||| || | ||| || || ||||||||||||||||||| |
|
|
| T |
25499539 |
caatatgtgggaattgattgtgccactgatttgatcaagacctctcttcctgctttcgagagatgttttctagaccattgttgtattttcc |
25499449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University