View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6959_high_17 (Length: 215)
Name: NF6959_high_17
Description: NF6959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6959_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 45 - 204
Target Start/End: Original strand, 51705158 - 51705317
Alignment:
| Q |
45 |
gttgtttatctaattaatcgagtgacatttcgtgttataagtaccattggtcttgttcagtttaggatctcattttttccttttgtaattgtcatgcata |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51705158 |
gttgtttatctaattaatcgagtgacatttcgtgttataagtaccattggtcttgttcagtttaggatctcattttttccttttgtaattgtcatgcata |
51705257 |
T |
 |
| Q |
145 |
gttttgaatcatgaatattttggcgtgttgattttttgggtattcacaagtaacaccaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
51705258 |
gttttgaatcatgaatattttggcatgttgattttttcggtattcacaagtaacaccaaa |
51705317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University