View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6959_high_19 (Length: 201)
Name: NF6959_high_19
Description: NF6959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6959_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 3852545 - 3852713
Alignment:
| Q |
19 |
ttatgatcactactactagttaaggcaagatttgtttcattttgaagacaaatgcttttgtgacttttaaacttcccacaaacttcttgttcttcttctt |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3852545 |
ttatgatcactactactagttaaagcaagatttgtttcattttgaagacaaatgcttttgtgacttttatacttcccacaaacttcttgttcttcttctt |
3852644 |
T |
 |
| Q |
119 |
tgacagcaacattgatcttccatttatctcttgatagcaacatgagggttatagcagcttcttcttcag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3852645 |
tgacagcaacattgatcttccatttatctcttgatagcatcatgagggttatagcagcttcttcttcag |
3852713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University