View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6959_low_12 (Length: 255)
Name: NF6959_low_12
Description: NF6959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6959_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 62 - 247
Target Start/End: Original strand, 38197201 - 38197386
Alignment:
| Q |
62 |
aactgatttaattaacacttctcttcctgctttggataaatgcttactcgaccattgttgtattttcctccaaactttgtctctcagatatccaaaaatt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38197201 |
aactgatttaattaacacttctcttcctgctttggataaatgcttacccgaccattgttgtattttcctccaaactatgtctctcagatatccaaaaatt |
38197300 |
T |
 |
| Q |
162 |
gctttcttgttacgcgccccaccatggatggcatgcccaaatacttcctgtttcccataccttccgacacttgaaggatattcttc |
247 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38197301 |
gatttcttgttacgcgccccaccatggatggcatgcccaaatacttcctgtttcccataccttccgacacttgaaggatattcttc |
38197386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 38197198 - 38197137
Alignment:
| Q |
1 |
acagtccattcctacatattgtatgagcacttttctgttaccaacttctttgggggaggaaa |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38197198 |
acagtccattcctacatattgtatgagcacttttctgttaccaactactttgggggaggaaa |
38197137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University