View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6959_low_17 (Length: 232)
Name: NF6959_low_17
Description: NF6959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6959_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 40695786 - 40695587
Alignment:
| Q |
16 |
ttgggcacaattgcggcatcacactacatcaaaccgcaacattttgctcacaaaaattatttttctagctttcagtctttaattttatcatagatttaag |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40695786 |
ttgggcacaatggcggcatcacactacatcaaaccgcaacattttgctcacaaaaattatttttctagctttcagtctttaattttatcatagatttgag |
40695687 |
T |
 |
| Q |
116 |
gattttttaaaaggatttcggatattctaaagtgatgaagagtgttgataatgatataaatatgagattttatagaggaaataggaaatgtgtaaagtat |
215 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40695686 |
ggttttttaaaaggatttcggatattctaaagtgatgaaaa--gttgataatgatataaatatgagattttatagaggaaataggaaatgtgtaaagtat |
40695589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University