View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6960_low_12 (Length: 352)
Name: NF6960_low_12
Description: NF6960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6960_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 19097263 - 19096928
Alignment:
| Q |
1 |
tccatcaaatatggaaactgccaatgcttacctctataaattctcatctaaaaattttaagcctcttatgatgattatgtaattgggatcaacagaggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19097263 |
tccatcaaatatggaaactgccaatgcttacctctataaattctcatctaaaaattttaagcctcttatgatgattatgtaattgggatcaacagagaat |
19097164 |
T |
 |
| Q |
101 |
taccagccggtggacccctttgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaatgttattgagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097163 |
taccagccggtggacccctttgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaatgttattgagttg |
19097064 |
T |
 |
| Q |
201 |
ctgcgtcaacggagtgctgctttcattggtgacaacaggtggtgaggaagaaggggtaacctgtgtttgccgcctcggcctcccccttcccctcccacta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097063 |
ctgcgtcaacggagtgctgctttcattggtgacaacaggtggtgaggaagaaggggtaacctgtgtttgccgcctcggcctcccccttcccctcccacta |
19096964 |
T |
 |
| Q |
301 |
ccgttcctagtcgagcttcttctagttaatcctgat |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19096963 |
ccgttcctagtcgagcttcttctagttaatcctgat |
19096928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 121 - 187
Target Start/End: Complemental strand, 32149164 - 32149098
Alignment:
| Q |
121 |
tgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaa |
187 |
Q |
| |
|
||||| || ||||||| ||||| || ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32149164 |
tgtctacggggccttcttgttgtctttccccaacctgttaggcttctatcctccaaacccacttcaa |
32149098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University