View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6960_low_19 (Length: 261)

Name: NF6960_low_19
Description: NF6960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6960_low_19
NF6960_low_19
[»] chr7 (1 HSPs)
chr7 (34-168)||(46942769-46942903)


Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 34 - 168
Target Start/End: Complemental strand, 46942903 - 46942769
Alignment:
34 aaaccaaaccaagcacccagatccagcaaccattgaccttcacttttcagacacgacaaacaatcaaaacttatcttgcttttgtcacgtttttcaatta 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46942903 aaaccaaaccaagcacccagatccagcaaccattgaccttcacttttcagacacgacaaacaatcaaaacttatcttgcttttgtcacgtttttcaatta 46942804  T
134 attaattaatcaacttgttcagtcagtgtactatt 168  Q
    |||||||||||||||||||||||||||||||||||    
46942803 attaattaatcaacttgttcagtcagtgtactatt 46942769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University