View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6960_low_19 (Length: 261)
Name: NF6960_low_19
Description: NF6960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6960_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 34 - 168
Target Start/End: Complemental strand, 46942903 - 46942769
Alignment:
| Q |
34 |
aaaccaaaccaagcacccagatccagcaaccattgaccttcacttttcagacacgacaaacaatcaaaacttatcttgcttttgtcacgtttttcaatta |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46942903 |
aaaccaaaccaagcacccagatccagcaaccattgaccttcacttttcagacacgacaaacaatcaaaacttatcttgcttttgtcacgtttttcaatta |
46942804 |
T |
 |
| Q |
134 |
attaattaatcaacttgttcagtcagtgtactatt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46942803 |
attaattaatcaacttgttcagtcagtgtactatt |
46942769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University