View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6960_low_26 (Length: 228)
Name: NF6960_low_26
Description: NF6960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6960_low_26 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 13121806 - 13122033
Alignment:
| Q |
1 |
tcaagttttagtatactatctcgttcttaaggataactaatgcatgaattattgctattgctgtttccatcacccatgtgggctaaggtggacatgttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13121806 |
tcaagttttagtatactatctcgttcttaaggataactaatgcatgaattattgctattgctgtttccatcacccatgtgggctaagatggacatgttgt |
13121905 |
T |
 |
| Q |
101 |
tgtttgaattgaaatgtatggttctagagaatggcatttgaaaaagatatgctcagagatttagtactgtcctatgaaagttattatcaacatccaacta |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13121906 |
tgtttgaattgaaatgtgcggttctagagaatggcatttgaaaaagatatgctcagagatttagtactgtcctatgaatgttattatcaacatccaacta |
13122005 |
T |
 |
| Q |
201 |
ccagtcaatgcagtgcaaaccatttgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13122006 |
ccagtcaatgcagtgcaaaccatttgat |
13122033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 210
Target Start/End: Original strand, 13111607 - 13111645
Alignment:
| Q |
172 |
ctatgaaagttattatcaacatccaactaccagtcaatg |
210 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
13111607 |
ctatgaatgttgttatcaacatccaactaccagtcaatg |
13111645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University