View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6961_high_7 (Length: 242)
Name: NF6961_high_7
Description: NF6961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6961_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 1783176 - 1783384
Alignment:
| Q |
20 |
aggacttcttgacaccccaagagatatccctaaaatgactgaatgtaacacaatgcctagctccaaaatctgcatattttgaatatatgactaatttaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1783176 |
aggacttcttgacaccccaagagatatccctaaaatgactgaatgtaacacaatgcctagctccaaaatctgcatattttgaatatatgactaatttaaa |
1783275 |
T |
|
| Q |
120 |
ataaaataaaatttagttcaaggtatctcttttagtcaacattatcaaatgttatggcacatgatactctnnnnnnntcttatattcacattccaatttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1783276 |
ataaaataaaatttagttcaaggtatctcttttagtcaacattatcaaatgttatggcacatgatactct-aaaaaatcttatattcacattccaatttt |
1783374 |
T |
|
| Q |
220 |
taagacttta |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
1783375 |
taagacttta |
1783384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University