View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6961_high_8 (Length: 241)
Name: NF6961_high_8
Description: NF6961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6961_high_8 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 96 - 241
Target Start/End: Original strand, 40552307 - 40552452
Alignment:
| Q |
96 |
gagagattgaaccttcttttgatcattgatgagacagattccaacgttcttgcggtaaccttcgggaggagcttccatcgttgacgttgaataacgccag |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40552307 |
gagagattgaaccttcttttgattattgatgagacagattccaacgttcttgcggtaaccttcgggaggagcttccatcgttgacgttgaataacgccag |
40552406 |
T |
|
| Q |
196 |
gctgcagaaagtggcagcgaaggtaatttggcgtatttgggagggt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40552407 |
gctgcagaaagtggcagcgaaggtaatttggcgtatttgggagggt |
40552452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 5 - 96
Target Start/End: Original strand, 40552094 - 40552185
Alignment:
| Q |
5 |
atggacatcagacacgacagtgacactgacatgtgacagaccagtagtaatttaaattaacaacgtagctgaatctaatcacatgtgttgtg |
96 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40552094 |
atggacaccagacacgacagtgacactgacatgtgacacaccagtagtaatttaaattaacaacgtagctgaatctaatcacatgtgctgtg |
40552185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University