View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_high_12 (Length: 354)
Name: NF6962_high_12
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 338
Target Start/End: Complemental strand, 27425968 - 27425630
Alignment:
| Q |
16 |
atccgaagccaagcaacacattatcatat-----tagcaatgcttcaaccaagaccatcactttttactgtttaactgcataatttagtgtagaaaaata |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425968 |
atccgaagccaagcaacacattatcatatcatattagcaatgcttcaaccaagaccatcactttttactgtttaactgcataatttagtgtagaaaaata |
27425869 |
T |
 |
| Q |
111 |
atatcaaaatctgcatataatgatatagcagttgcaacattgaataaagtgtttttactcaccttccatccacaatctagatgccaatatttcgctatat |
210 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425868 |
atatcaaaatctgcatataatgatataacagttgcaacattgaataaagtgtttttactcaccttccatccacaatctagatgccaatatttcgctatat |
27425769 |
T |
 |
| Q |
211 |
a-----------ttatggttagcatttgcccttcttgaactttatcttcttctccaaatcatgtcaccaaaagaacaattagaaacttgaataatcacca |
299 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425768 |
ataacagttcctttatggttagcatttgcccttcttgaactttatcttcttctccaaatcatgtcaccaaaagaacaattagaaacttgaataatcacca |
27425669 |
T |
 |
| Q |
300 |
accattcactcattcttctctttcacgtggccaccataa |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425668 |
accattcactcattcttctctttcacgtggccaccataa |
27425630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University