View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_high_19 (Length: 309)
Name: NF6962_high_19
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 386756 - 386980
Alignment:
| Q |
18 |
atgaatgtcatacaatttgcttcatctctaaatatttggattattatatctaacatttactttacttctttggttaagtgacttataaaaacaactttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386756 |
atgaatgtcatacaatttgcttcatctctaaatatttggattattatatctaacatttactttacttctttggttaagtgacttataaaaacaactttat |
386855 |
T |
 |
| Q |
118 |
aatgtttgctttatctttaacatttataaataacatactgctagtgtgaaacctgctttagaatgccatacgatttgtctataatagcatatttggagtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386856 |
aatgtttgctttatctttaacatttataaataacatactgctagtgtgaaacctgctttagaatgccatacgatttgtctataatagcatatttggagtg |
386955 |
T |
 |
| Q |
218 |
ttggaagcggaggaattgtgccacc |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
386956 |
ttggaagcggaggaattgtgccacc |
386980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University