View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_high_23 (Length: 297)
Name: NF6962_high_23
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 19 - 288
Target Start/End: Original strand, 51739567 - 51739836
Alignment:
| Q |
19 |
gtaatgggtgtaatttttggtctatctgtctcattttatttatatcaagaattaggcatcgatggttcaaggttttatttctgtatgattattatgttag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51739567 |
gtaatgggtgtaatttttggtctatctgtctcattttatttatatcaagaattaggcatcgatggttcaaggttttatttctgtatgattattatgttag |
51739666 |
T |
 |
| Q |
119 |
ttgtatcatacacaagttcccctatggtcatccgtttggcagcagatttaaggtttgccgcatctgatgtcggtcgaatcgctgtgtctgccgcattgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51739667 |
ttgtatcatacacaagttcccctatggtcatccgtttggcagcagatttaaggtttgccgcatctgatgtcggtcgaatcgctgtgtccgccgcattgat |
51739766 |
T |
 |
| Q |
219 |
tgtagaaatgggttgcttattggtgtttaatatgatggttaatacgaagatggatgataagaagtataat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51739767 |
tgtagaaatgggttgcttattggtgtttaatatgatggttaatacgaagatggatgataagaagtataat |
51739836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 121 - 240
Target Start/End: Original strand, 10200362 - 10200481
Alignment:
| Q |
121 |
gtatcatacacaagttcccctatggtcatccgtttggcagcagatttaaggtttgccgcatctgatgtcggtcgaatcgctgtgtctgccgcattgattg |
220 |
Q |
| |
|
|||||||||||||| ||||| ||||| || |||||| | || || ||| | ||||| ||||| ||| |||| |||||||| |||||| | || |||||| |
|
|
| T |
10200362 |
gtatcatacacaagctcccccatggtgattcgtttgacggcggagttacgatttgctgcatccgatatcgggcgaatcgcggtgtcttcagcgttgatta |
10200461 |
T |
 |
| Q |
221 |
tagaaatgggttgcttattg |
240 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
10200462 |
cagaaatggcttgcttattg |
10200481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University