View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6962_high_30 (Length: 256)

Name: NF6962_high_30
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6962_high_30
NF6962_high_30
[»] chr6 (2 HSPs)
chr6 (175-243)||(15279650-15279715)
chr6 (51-113)||(15279778-15279840)


Alignment Details
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 175 - 243
Target Start/End: Complemental strand, 15279715 - 15279650
Alignment:
175 ctatcgttcgttctttgatactttgtgtcggttgggagttttcacggtggttcttttgtgtatcagagc 243  Q
    |||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||    
15279715 ctatcgttcgttctttgat---ttgtgtcggttgggagttttcacggtggttcttttgtgtatcagagc 15279650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 51 - 113
Target Start/End: Complemental strand, 15279840 - 15279778
Alignment:
51 tgaaaacattagaaatcgtttcattccggccaccattactaccgcgctggtgtagctccaata 113  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||    
15279840 tgaaaacattagaaatcgtttcgttctggccaccattactaccgcgctggtgtagctccaata 15279778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University