View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_high_32 (Length: 237)
Name: NF6962_high_32
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_high_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 25 - 219
Target Start/End: Complemental strand, 39696476 - 39696282
Alignment:
| Q |
25 |
tcttcctctcttcttatgacgagcctgagatgcatcgtcatcagaatcatcttcagaatcatcgtctccggaatcaaaaaattgattttttgatgaaggt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39696476 |
tcttcctctcttcttatgacgagcctgagatgcatcgtcatcagaatcatcttcagaatcatcgactccggaatcaaaaaattgattttttgatgaaggt |
39696377 |
T |
|
| Q |
125 |
gggagagaatgtttgtttataccagcagcctccaaaaggtcattttctaaatcagccataatttgtctgcatgtataacacaatgtatataatca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39696376 |
gggagagaatgtttgtttataccagcagcctccaaaaggtcattttctaaatcagccataatttgtctgcatgtataacacaatgtatataatca |
39696282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University