View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_high_33 (Length: 234)
Name: NF6962_high_33
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 12 - 216
Target Start/End: Complemental strand, 37480013 - 37479800
Alignment:
| Q |
12 |
acatcaagtcgatgaccgatagaggttgagcttgatttatagaacatacatgtgtatactcatacattgtggtg--nnnnnnnnnnnnnnccacttgaat |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37480013 |
acataaagtcgatgaccgatagaggttgaacttgatttatagaacatacatgtgtatactcatacattgtggtgtttttttttcctttttccacttgaat |
37479914 |
T |
|
| Q |
110 |
aatgacattcaaatatatataaacatgaaattacgcttagttgagttcccaaagatgtagaccagt---------gggttgggacattgaaagaggttag |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
37479913 |
aatgacattcaa--atatataaacatgaaattacgcttagttgagttcccaaagatgtagaccagtaggtaaaaagggttggtacattgaaagaggttag |
37479816 |
T |
|
| Q |
201 |
gaaggaagaccagggt |
216 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
37479815 |
gatggaagaccagggt |
37479800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 162
Target Start/End: Complemental strand, 37475556 - 37475526
Alignment:
| Q |
132 |
acatgaaattacgcttagttgagttcccaaa |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37475556 |
acatgaaattacgcttagttgagttcccaaa |
37475526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University