View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6962_high_37 (Length: 212)

Name: NF6962_high_37
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6962_high_37
NF6962_high_37
[»] chr8 (1 HSPs)
chr8 (17-193)||(35327561-35327731)


Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 35327561 - 35327731
Alignment:
17 gtgaacctggaggcacatagcagcatcgagtgtgttgcgaatgcaggttaagtataagcgtaatgttgtgctaccctgaaatcaaaaacacatgaattga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35327561 gtgaacctggaggcacatagcagcatcgagtgtgttgcgaatgcaggttaagtataagcgtaatgttgtgctaccctgaaatcaaaaacacatgaattga 35327660  T
117 gaagatgaagatggaaaattgcgatgatgaagaacaagattcagtgtgtatcgtaccattgctttgggtctgaatct 193  Q
    ||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35327661 gaagatga------aaaattgcgatgatgaagaacaagattcagtgtgtatcgtaccattgctttgggtctgaatct 35327731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University