View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_high_38 (Length: 208)
Name: NF6962_high_38
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 16 - 190
Target Start/End: Complemental strand, 46565367 - 46565193
Alignment:
| Q |
16 |
aatatcatagatgttaaaattgaaaactaaaaatagagatgtagtagaaatggcttacgagtgatggtactatggtaagtacttaatgtttgaattcatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46565367 |
aatatcatagatgttaaaattgaaaactaaaaatagagatgtaatagaaatggcttacgagtgatgctactatggtaagtacttaatgtttgaattcatt |
46565268 |
T |
 |
| Q |
116 |
ataaattttaactgaattttgatgagcgactgtgataaattcattgtgatacaaacatgcattaagaatgtcttt |
190 |
Q |
| |
|
||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46565267 |
ttaactgaattttgaattttgatgagcgactgtgataaattcattgtgatacaaacatgcattaagaatgtcttt |
46565193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University