View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_low_23 (Length: 343)
Name: NF6962_low_23
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_low_23 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 32387934 - 32387592
Alignment:
| Q |
1 |
tttccctctcacactctcttcttaacacaaatccaacatgattcgccaaaaatcaattctctcatttttccataaaacctcgccggaaaatcgcacttcc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32387934 |
tttccatctcacactctcttcttaacacaaatccaacatgattcgccaaaaatcaattctctcattcttccataaaacctcgccggaaaatcgcacttcc |
32387835 |
T |
 |
| Q |
101 |
gccgccgcaaaaaccaccgctccgtccgctccgcaatccaaccccgaagatcgtactataaaaccagtcgtcaatccaccgccgccgtcagatgacgtca |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32387834 |
gccgccgcaaaaaccaccgctccatccgctccgcaatccaaccccgaagatcgtactatcaaaccagtcgtcaatccaccgccgccgtcagatgacgtca |
32387735 |
T |
 |
| Q |
201 |
gaggaactgacactccgccggagaaggtgccgcgtcaggttttaccggctaactacgtggcgaacacgaagaactcaggttcttgtttgtttgagagtat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32387734 |
gaggaactgacactccgccggagaaggtgccgcgtcaggttttaccggctaactacgtggcgaacacgaagaactcaggttcttgtttgtttgagagtat |
32387635 |
T |
 |
| Q |
301 |
catgcataagtttattaaggttgatgatggcgaaaaggttaac |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32387634 |
catgcataagtttattaaggtcgatgatggcgaaaaggttaac |
32387592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University