View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_low_36 (Length: 286)
Name: NF6962_low_36
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 10612720 - 10612452
Alignment:
| Q |
1 |
aatattatccattgttgaaaaatgaaaataatgtactatactatatacctatatctatcaccattcaaaacaaaacaaaataaaacattttcttttgtga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10612720 |
aatattatccattgttcgaaaatgaaaataaggtactatactatataccaatatctatcaccattcaaaacaaaacaaaataaaacattttcttttgtga |
10612621 |
T |
 |
| Q |
101 |
gtttctagaatatttgacctaaagagaacaacataatataaactaaattctttttatgactttagaaatatttgacttataaatagaacgaaacaacgtc |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
10612620 |
gtttttagaatatttgacctaaagagaacaacataatataaaataaattctttttagtactttagaaatatttgacttataactagaacgaaacaacatc |
10612521 |
T |
 |
| Q |
201 |
tatttagaaatttttaggctataatcaaaacaaatccaaagcaaaaatatgacattgtgaaataaaaagt |
270 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10612520 |
tatttagaaatttttaggatataatcaaaacaaatccaaagc-aaaatatgacattgtgaaataaaaagt |
10612452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University