View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_low_42 (Length: 256)
Name: NF6962_low_42
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_low_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 175 - 243
Target Start/End: Complemental strand, 15279715 - 15279650
Alignment:
| Q |
175 |
ctatcgttcgttctttgatactttgtgtcggttgggagttttcacggtggttcttttgtgtatcagagc |
243 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15279715 |
ctatcgttcgttctttgat---ttgtgtcggttgggagttttcacggtggttcttttgtgtatcagagc |
15279650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 51 - 113
Target Start/End: Complemental strand, 15279840 - 15279778
Alignment:
| Q |
51 |
tgaaaacattagaaatcgtttcattccggccaccattactaccgcgctggtgtagctccaata |
113 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15279840 |
tgaaaacattagaaatcgtttcgttctggccaccattactaccgcgctggtgtagctccaata |
15279778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University