View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6962_low_49 (Length: 222)
Name: NF6962_low_49
Description: NF6962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6962_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 203
Target Start/End: Original strand, 41624226 - 41624418
Alignment:
| Q |
11 |
cgaagaatatcgcggctgtggatttgtggaccatgcttaatcaatgtgcacaagctgtggcgagctacgatcaaaggaatacagatgagctactcaaaca |
110 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41624226 |
cgaaaaatgtcgcggctgtggatttgtggaccatgcttaatcaatgtgcacaagctgtggcgagctacgatcaaaggaatacagatgagctactcaaaca |
41624325 |
T |
 |
| Q |
111 |
gattaggcaacactcttcgcctttcggcgatggactccaacgtttagctcattactttgctaatggtcttgagataagattggctgccgagac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41624326 |
gattaggcaacactcttcgcctttcggcgatggactccaacgtttagctcattactttgctaatggtcttgagataagattggctgccgagac |
41624418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 203
Target Start/End: Original strand, 41627197 - 41627379
Alignment:
| Q |
21 |
cgcggctgtggatttgtggaccatgcttaatcaatgtgcacaagctgtggcgagctacgatcaaaggaatacagatgagctactcaaacagattaggcaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41627197 |
cgcggctgtggatttgtggaccatgctaaatcaatgtgcacaagctgtggcgagctacgatcaaaggaatacagatgagctactcaaacagattaggcat |
41627296 |
T |
 |
| Q |
121 |
cactcttcgcctttcggcgatggactccaacgtttagctcattactttgctaatggtcttgagataagattggctgccgagac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41627297 |
cactcttcgcctttcggcgatggactccaacgtttagctcattactttgctaatggtcttgagataagattggctgctgagac |
41627379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 27 - 202
Target Start/End: Original strand, 41620896 - 41621071
Alignment:
| Q |
27 |
tgtggatttgtggaccatgcttaatcaatgtgcacaagctgtggcgagctacgatcaaaggaatacagatgagctactcaaacagattaggcaacactct |
126 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||||| || ||||| ||||| ||||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
41620896 |
tgtggatttgtggactatgctaactcaatgtgcacaggccgtggcaagctatgatcaaaggaatacaaatgagctactcaagcagattaggaaacactct |
41620995 |
T |
 |
| Q |
127 |
tcgcctttcggcgatggactccaacgtttagctcattactttgctaatggtcttgagataagattggctgccgaga |
202 |
Q |
| |
|
|||||||| || |||||||| || || |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41620996 |
tcgccttttggggatggacttcagcggttagctcattactttgctaatggtcttgagataagatttgctgccgaga |
41621071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 51 - 183
Target Start/End: Original strand, 23930095 - 23930227
Alignment:
| Q |
51 |
tcaatgtgcacaagctgtggcgagctacgatcaaaggaatacagatgagctactcaaacagattaggcaacactcttcgcctttcggcgatggactccaa |
150 |
Q |
| |
|
|||||||||||||||||| | ||||| |||||||||||| || |||| |||| || ||||||||||| || |||||||| ||||||||||| || |
|
|
| T |
23930095 |
tcaatgtgcacaagctgttggtagctatgatcaaaggaatgcaaatgatatactgaagcagattaggcagcattcttcgccaagtggcgatggacttcag |
23930194 |
T |
 |
| Q |
151 |
cgtttagctcattactttgctaatggtcttgag |
183 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| |
|
|
| T |
23930195 |
cgtttagctcattactttgctgatggacttgag |
23930227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 95 - 183
Target Start/End: Complemental strand, 23912438 - 23912350
Alignment:
| Q |
95 |
atgagctactcaaacagattaggcaacactcttcgcctttcggcgatggactccaacgtttagctcattactttgctaatggtcttgag |
183 |
Q |
| |
|
|||||||||| || |||||||||||||| ||||| || | || ||||||| ||| | || |||||||||||||| ||||| |||||| |
|
|
| T |
23912438 |
atgagctactgaagcagattaggcaacattcttcaccctctggggatggaccacaaaggttggctcattactttgccaatggccttgag |
23912350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University