View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6965_high_11 (Length: 316)
Name: NF6965_high_11
Description: NF6965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6965_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 306
Target Start/End: Complemental strand, 24069763 - 24069467
Alignment:
| Q |
11 |
acatcattccacaaccctcgaaataccgttacccctactccttcnnnnnnnnnnnnn--taccgttaccccttacaaagcagttctttttataatcttct |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24069763 |
acatcattccacaaccctcaaaataccgttacccctactccttcaaaaaaaaaaaaaaataccgttacccct-acaaagcagttctttttataatcttct |
24069665 |
T |
 |
| Q |
109 |
ccaaattctctttcgttgtcacaaaacaattcacaattcccaaataatcaaatttaataatcaacnnnnnnntgttccgcataagcaacacattggttgg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24069664 |
ccaaattctctttcgttgtcacaaaacaattcacaattcccaaataaacaaatttaataatcaacaaaaaaatgttccgcataagcaacacattggttgg |
24069565 |
T |
 |
| Q |
209 |
aaccctaaacattctaaccttactgctttcactcgctggcatggctggttctgcatacattcacttccacaaaaccgactgccttaaagtgttgatgt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
24069564 |
aaccctaaacattctaaccttactgctttcactcgctggcatggctggttctgcatacatccacttccataaaacagactgccttaaagtgttgatgt |
24069467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University