View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6965_high_12 (Length: 313)
Name: NF6965_high_12
Description: NF6965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6965_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 1256611 - 1256315
Alignment:
| Q |
1 |
agtgttgacatatgttaacagatattatctcaagtttttgttcatgtttttcacatactgtaatgcaaacatatattttggaaattctctcaaactattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1256611 |
agtgttgacatatgttaacagatattatctcaagtttttgttcatgtttttcacatactgtaatgcaaacatatattttggaaattctctcaaactattt |
1256512 |
T |
 |
| Q |
101 |
gcattttgaacaagcatttccctttttggtattcttcatttgtacc-attaaaatctcatgtcttttgcctcttcannnnnnncagggaatatagaagat |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1256511 |
gcattttgaacaagcatttccctttttagtattcttcatttgtgcctattaaaatctcatgtcttttgcctcttca-ttttttcagggaatatagaagat |
1256413 |
T |
 |
| Q |
200 |
tgcaacttttgaagatggctgcaacctttgcttccagatgttctcgtggtatgttgtttttaatgtgactttcaccacatatttattagattgatgtc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1256412 |
tgcaacttttgaagatggctgcaacctttgcttccagatgttctcgtggtatgttgtttttaatgtgactttcaccacatatttattagattgatgtc |
1256315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 64 - 259
Target Start/End: Complemental strand, 42191522 - 42191326
Alignment:
| Q |
64 |
tgcaaacatatattttggaaattctctcaaactatttgcattttgaacaagcatttccctttttggtattcttcatttgtacc-attaaaatctcatgtc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
42191522 |
tgcaaacatatattttggaaattctctcaaactatttgcattttgaagaagcatttccctttttggtattcttcatttgtgcctattaaaatctcatgtc |
42191423 |
T |
 |
| Q |
163 |
ttttgcctcttcannnnnnncagggaatatagaagattgcaacttttgaagatggctgcaacctttgcttccagatgttctcgtggtatgttgtttt |
259 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42191422 |
ctttggctcttcattttttttagggaatataaaagattgcaacttttgaagatggctgcaacctttgcttccagatgttctcgtggtatgttgtttt |
42191326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 297
Target Start/End: Complemental strand, 42191136 - 42191104
Alignment:
| Q |
265 |
tgactttcaccacatatttattagattgatgtc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42191136 |
tgactttcaccacatatttattagattgatgtc |
42191104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 297
Target Start/End: Complemental strand, 42191827 - 42191795
Alignment:
| Q |
265 |
tgactttcaccacatatttattagattgatgtc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42191827 |
tgactttcaccacatatttattagattgatgtc |
42191795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University