View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6965_high_16 (Length: 250)
Name: NF6965_high_16
Description: NF6965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6965_high_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 2143210 - 2143438
Alignment:
| Q |
13 |
aatataaaaatttagaagttaagtaaatcactccaataactttggcccccctttttgatcctttctatttttgacaaacaataatgctttaagatcccac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2143210 |
aatataaaaatttagaagttaagtaaatcactccaataactttggcccccctttttgatcctttctatttttgacaaacaataatgctttaagatcccac |
2143309 |
T |
 |
| Q |
113 |
catccaaaagtcacaaactgatatgatgcaccatgataatcatgatgatttgctcaatgttttcaccttcaagctattcttcaaactactatgcagtggt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2143310 |
catccaaaagtcacaaactgatatgatgcac---------catgatgatttgctcaatgttttcaccttcaagctattcttcaaactactatgcagtggt |
2143400 |
T |
 |
| Q |
213 |
tataacctactaagatgtgatgtgcctcaactttatat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2143401 |
tataacctactaagatgtgatgtgcctcaactttatat |
2143438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University