View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6965_high_18 (Length: 237)
Name: NF6965_high_18
Description: NF6965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6965_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41637351 - 41637574
Alignment:
| Q |
1 |
aatctgaaatccatgaacgacttgttggtaggggataaatcactatacggtcttggtgaagatg--atgtggtcattatgcttgatgatgagaggttgaa |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41637351 |
aatctgaaatccatgaacgaattgttggtaggggataaatcactatacggtcttagtgaagatgcgatgtggtcattatgcttgatgatgagaggttgaa |
41637450 |
T |
|
| Q |
99 |
tccaacctcaccaatggttcttaacaaactagaggacatgatcttagccatggaagatggagattgcatattgttctacttttgtggccatggtggccgc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637451 |
tccaacctcaccaatggttcttaacaaactagaggacatgatcttagccatggaagatggagattgcatattgttctacttttgtggccatggtggccgc |
41637550 |
T |
|
| Q |
199 |
tacaaagtaaaacaatggtctaac |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41637551 |
tacaaagtaaaacaatggtctaac |
41637574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University