View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6965_high_8 (Length: 360)
Name: NF6965_high_8
Description: NF6965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6965_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 22 - 345
Target Start/End: Original strand, 43578682 - 43579005
Alignment:
| Q |
22 |
atgttaagggacaatgttgaaccgaatgaagcgacgtttactaatgctgctaggttagctgctgctaaggaggatcctgagatggcatttgagttgttga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578682 |
atgttaagggacaatgttgaaccgaatgaagcgacgtttactaatgctgctaggttagctgctgctaaggaggatcctgagatggcatttgagttgttga |
43578781 |
T |
 |
| Q |
122 |
agcagatgaagagagttggaattgcaccaaagttgaggtcttatggtccggctttgtatggtttttgtgcgagaggggatgctatgaaagcttatgaggt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578782 |
agcagatgaagagagttggaattgcaccaaagttgaggtcttatggtccagctttgtatggtttttgtgcgagaggggatgctatgaaagcttatgaggt |
43578881 |
T |
 |
| Q |
222 |
tgatgatgatatgattgagtcaggtgttatggcggaggaggatgagctctgtgcatttttggaggttagtgttgaggtgaagaatgaagataaggtgtat |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578882 |
tgatgatgatatgattgagtcaggtgttatggcggaggaggatgagctctgtgcacttttggaggttagtgttgaggtgaagaatgaagataaggtgtat |
43578981 |
T |
 |
| Q |
322 |
gagatattgcatcggttacgggcc |
345 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
43578982 |
gagatattgcatcggttaagggcc |
43579005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University