View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6965_low_33 (Length: 217)

Name: NF6965_low_33
Description: NF6965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6965_low_33
NF6965_low_33
[»] chr1 (1 HSPs)
chr1 (14-195)||(45104827-45105008)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 45105008 - 45104827
Alignment:
14 aagaaaaaggagagaagtgagttaccagaaccaagcaagaaaggcaagagaagtgtgccagtggaacttataactcgtcgaagatcagccctaaagagaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45105008 aagaaaaaggagagaagtgagttaccagaaccaagcaagaaaggcaagagaagtgtgccagtggaacttataactcgtcgaagatcagccctaaagagaa 45104909  T
114 gcaagggaatggcgagaggaagaagaaacttcagaaccaagtcataagcaggagcattaacagaaagaatccccaaattact 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45104908 gcaagggaatggcgagaggaagaagaaacttcagaaccaagtcataagcaggagcattaacagaaagaatccccaaattact 45104827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University