View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6965_low_6 (Length: 470)
Name: NF6965_low_6
Description: NF6965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6965_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 308; Significance: 1e-173; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 66 - 441
Target Start/End: Original strand, 38829510 - 38829885
Alignment:
| Q |
66 |
tggagaatctccttcgatccaaagagtattaggttgccgtcgagtcaggatacacagagccaacaagtagagatgggatgaccgcagtgcaaataaagaa |
165 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| | ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829510 |
tggagaatctccttcgatacaaagagtattgggttgctgccgaatcaggatacacagtgccaacaagtagagatgggatgaccgcagtgcaaataaagaa |
38829609 |
T |
|
| Q |
166 |
tctggatgagatgaagctgaaggatttgaaggctaagaattacttgtttcagtcaattgacaagtcaattctgaagaccatcacgcagaaggagacatct |
265 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
38829610 |
tctggatgacatgaagctgaaggatttgaaggctaagaattacttgtttcagttaattgacaagtcaattctgaagacgaacacgcagaaggagacatct |
38829709 |
T |
|
| Q |
266 |
aaacagctatgggattccatgaagttgaagtgtcgcggcaatgctcgagtgaagagagcacagctcaatcgtctacgccgagactttgaggtcttagcaa |
365 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38829710 |
aaacggctatgggattccatgaagttgaagtgtcgcgacaatgctcgagtgaagagagcacaactcaatcatctacgccgagactttgaggtcttagcaa |
38829809 |
T |
|
| Q |
366 |
tgaagcagggtgaatcgatcactgattattttagtcgagtaatgacagttgcaaacgacatgaggaattatgggga |
441 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38829810 |
tgaagcagggtgaatcaatcactgattattttggtcgagtaatgacggttgcaaacgacatgaggaattatgggga |
38829885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 38829475 - 38829514
Alignment:
| Q |
18 |
cctccataccaaagtttgacggcgactacgatcattggag |
57 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38829475 |
cctccataccgaagtttgacggcgactacgatcattggag |
38829514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University