View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6966_high_10 (Length: 294)
Name: NF6966_high_10
Description: NF6966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6966_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 43527068 - 43526806
Alignment:
| Q |
1 |
ttgtccatctgaacctttaatcaagc----cacacttcattcctacaacatgaagtaattaagacaatagatggagtctcgaagcatatttttaaaaacc |
96 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43527068 |
ttgtccatctgaacctttaatcaagctagccacacttcattcctacaacatgaagtaattaagacaatagatggagtcttgaagcatatttttaaaaacc |
43526969 |
T |
 |
| Q |
97 |
tgatcagccggtcgaaccagtccaatcggaaaccggatggttaaccggttccatttagtgatcagatcggttatgttatcaacccgttatggaccagttt |
196 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43526968 |
ggatcagcc---------agtccaatcgggaaccggatggttaaccggttccatttagtgatcagatcggttatgttatcaacccgttatggaccagttt |
43526878 |
T |
 |
| Q |
197 |
aatccggcaagatccggattaaatcggcgaaccggatgttatattaaaccggccgggtcaacttattgaccc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
43526877 |
aatccggcaagatccggattaaatcggcgaaccggatgttatattaaaccggccgactcatcttattgaccc |
43526806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University