View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6966_high_11 (Length: 264)
Name: NF6966_high_11
Description: NF6966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6966_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 6 - 253
Target Start/End: Complemental strand, 18050637 - 18050390
Alignment:
| Q |
6 |
atgagatggacatcaaagtacaggtctccctcggcaagatcccccttaatggtagacttgataaaggtcaaatcatgaggccagggaaacacaaaatttt |
105 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18050637 |
atgagatctacatcaaagtacaagtctccctctgcaagatcccccctaatggtagacttgataaaggtcaaatcatgaggccagggaaacacaaaatttt |
18050538 |
T |
|
| Q |
106 |
taggctagcccaaaatgtatgcacagatggaaacaaagtaaagtaactccaccactatcaattgtctatcttagagggtgacaagaccattcttgagtga |
205 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18050537 |
taggctagcccaaaatgtatgcatagatggaaacaaagtaaagtaactccacaactatcaattgtctatcttagagggtgacaagaccattcttgagtga |
18050438 |
T |
|
| Q |
206 |
ccctcgatcccgtgagaagggtaagttggcccttcaagatgtccatct |
253 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||| |||||| |
|
|
| T |
18050437 |
ccctcgatcccgcgagaagggtaagttggcccttcaggatggccatct |
18050390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University