View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6966_high_6 (Length: 372)
Name: NF6966_high_6
Description: NF6966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6966_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 9e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 24 - 140
Target Start/End: Complemental strand, 44407957 - 44407841
Alignment:
| Q |
24 |
agttgccgagtagaagcttctagggtgttttacttttgttattagcagcccaatttgtgtttcgtttgcgggttccctcacttcttcaacacagcttgca |
123 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407957 |
agttgccgaatagaagcttctagggtgttttacttttgttattagcagcccaatttgtgttgcgtttgcgggttccctcacttcttcaacacagcttgca |
44407858 |
T |
|
| Q |
124 |
atcaatttttgttcttc |
140 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44407857 |
atcaatttttgttcttc |
44407841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 212 - 352
Target Start/End: Complemental strand, 44407768 - 44407628
Alignment:
| Q |
212 |
agtacactaaaaaatacatacaatagaaataattttctcagtcgtcactaggagcttagctcagttgataggggtaatatattatatatgctggagcagg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| || ||||| |||||||||| ||| ||||| |
|
|
| T |
44407768 |
agtacactaaaaaatacatacaatagaaataattttctcagtcgtcactacgagtttagctcagttgatatggataatacattatatatgttggggcagg |
44407669 |
T |
|
| Q |
312 |
agtttgaactctcgacaccacaattctccacgttaaaatgt |
352 |
Q |
| |
|
|||| |||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
44407668 |
agttcgaactctcgacacctcaattctccacattaaaatgt |
44407628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University