View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6966_low_21 (Length: 210)
Name: NF6966_low_21
Description: NF6966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6966_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 7685076 - 7685242
Alignment:
| Q |
1 |
aagtttggtttttgaaacccatttaaatgacttcgaggggctcttctccattttcattcttgcagcttcactgagttttgcaacatatctttgattaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7685076 |
aagtttggtttttgaaacccatttaaatgacttcgaggggctcttctccattttcattcttgcagcttcactgagttttgcaacatatctttgattaggt |
7685175 |
T |
 |
| Q |
101 |
ctaattaagagccttgtacattcacttggaatacaatcaatataaaaaactctagaatttcaccgcc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7685176 |
ctaattaagagccttgtacattcacttggaatacaatcaatataaaaaactctagaatttcaccgcc |
7685242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University