View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6967_high_2 (Length: 263)
Name: NF6967_high_2
Description: NF6967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6967_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 42858118 - 42858373
Alignment:
| Q |
1 |
atcccataacctgctgcgtttcccagggtcttcaacacattcttctcgaacaatctcccaacccatttcttgtatcaaatcatgcatggatacaattgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42858118 |
atcccataacctgctgcgtttcccagggtcttcaacacattcttctcgaacaatctcccaacccatttcttgtatcaaatcatgcatggatacaattgat |
42858217 |
T |
 |
| Q |
101 |
cttccagagcccttggcttcaattataagggctttatctttaaggactcttaatccgataattgttgagaaaccacaggcatcaagcagagctattatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42858218 |
cttccagagcccttggcttcaattataagggctttatctttaaggactcttaatccgataattgttgagaaaccacaggcatcaagcagagctattatct |
42858317 |
T |
 |
| Q |
201 |
gttgcacttcatatcccttcaaaagacatgcaatatacaaaaatatgttcttctct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42858318 |
gttgcacttcatatcccttcaaaagacatgcaatatacaaaaatatgttcttctct |
42858373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 23404914 - 23404952
Alignment:
| Q |
49 |
aacaatctcccaacccatttcttgtatcaaatcatgcat |
87 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
23404914 |
aacaatctcccatcccatttcttgtaacaaatcatgcat |
23404952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University