View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6967_high_4 (Length: 221)
Name: NF6967_high_4
Description: NF6967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6967_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 17261347 - 17261556
Alignment:
| Q |
1 |
ttagtttgcataataggctttatattacaattaatgttactattgctagctcttagatatttggcacatataagatcgtgaaagatgtggttattataac |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17261347 |
ttagtttgcatcataggctttatattacaat----gttactattgctagctcttagatatttggcacatataagatcgtgaaagatgtggttattataac |
17261442 |
T |
 |
| Q |
101 |
ccataccaattcaaacaataaaagatattgctacaccatatcgaccgcatttattaccggctgaaaatacaggctaacaacatcgtcgtctcagtgcgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
17261443 |
ccataccaattcaaacaataaaagatattgctacaccatatcgaccgcatttattacctgttgaaaatacagcct-acaacatcgtcgtctcggtgcgtc |
17261541 |
T |
 |
| Q |
201 |
gttgtgatgtccatc |
215 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
17261542 |
gttgtgatgttcatc |
17261556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University