View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6967_low_2 (Length: 376)
Name: NF6967_low_2
Description: NF6967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6967_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 13 - 370
Target Start/End: Original strand, 25518843 - 25519201
Alignment:
| Q |
13 |
ggacatcacaacgttgttagtgtagccaaacctcacacctaattttgatgcaaaccacactgtttttacccactcacaatgcataaataatgatttgctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25518843 |
ggacatcacaacgttgttagtgtagccaaatctcacacctaattttgatgcaaaccacactgtttttacccactcacaatgcataaataaagatttgctt |
25518942 |
T |
|
| Q |
113 |
aaatgcagattttgcggattttaatatatgttaatatttccactttttgtttcgataaatcaattgtatttattcttttattgtttagt-gtattgactc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25518943 |
aaatgcagattttgcggattttaatatatgttaatatttccactttttgtttcgataaatcaattgtatttattcttttattgtttagtggtattgactc |
25519042 |
T |
|
| Q |
212 |
ttgttcttattcttgtagttttgtttttcaggatacctgatttacactgtacacagtgctatcaatgaatccagttccttttcagtctgcacctccgcca |
311 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25519043 |
ttttccttattcttgtagttttgtttttcaggatacctgatttacactgtacacattgctatcaatgaatccagttccttttcagtctgcacctccgcca |
25519142 |
T |
|
| Q |
312 |
ccaccacaactttttcttgaacctatgcagcttccaatattaccacccgaaccaccaaa |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25519143 |
ccaccacaactttttcttgaacctatgcagcttccaatattaccacccgaaccaccaaa |
25519201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University