View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6968_high_2 (Length: 284)
Name: NF6968_high_2
Description: NF6968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6968_high_2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 21 - 284
Target Start/End: Complemental strand, 30183499 - 30183242
Alignment:
| Q |
21 |
ttcataggtttaaatcaattaatttagagtagaatttgttgttgcaaaatataagcaatcaccgacatcaagttcagtagttcactataaatgtactttt |
120 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183499 |
ttcataggtttaaatcaattaatttagtgtagaatttgttgttgcaaaatataagcaatcaccgacatcaagttcagtagttcactataaatgtactttt |
30183400 |
T |
|
| Q |
121 |
aacgaa----------------ctttgcaatacaggtagttgattcccacttctcacacgcggacttttacttggacaagaggatcattcaagtttgaag |
204 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30183399 |
aacgaaatgtacttttaacgaactttgcaatac----------------------acacgcggacttttactaggacaagaggatcattcaagtttgaag |
30183322 |
T |
|
| Q |
205 |
taacctaatttctttgttgaatggtggttctaacttctaagtaacttggcatgtgatttggctgtttaactaaggtgtga |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183321 |
taacctaatttctttgttgaatggtggttctaacttctaagtaacttggcatgtgatttggctgtttaactaaggtgtga |
30183242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University