View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6969_high_2 (Length: 371)
Name: NF6969_high_2
Description: NF6969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6969_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 19 - 360
Target Start/End: Complemental strand, 40383035 - 40382694
Alignment:
| Q |
19 |
ctgttggacttgccggcgggacatctggtttcctcttttactttttcaccattttagcttccttctgggctgggagctccttcgtcacgttcctctccgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383035 |
ctgttggacttgccggcgggacatctggtttcctcttttactttttcaccattttagcttccttctgggctgggagctccttcgtcacgttcctctccgg |
40382936 |
T |
 |
| Q |
119 |
cgttgtttcgcatgtgatgcttggtttcaccgttgtggttgctattttagcttactttcttctcttcagtggattcttcatcagtagggataggattcca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40382935 |
cgttgtttcgcatgtgatgcttggtttcaccgttgtggttgctattttagcttactttcttctcttcagtggattcttcataagtagggataggattcca |
40382836 |
T |
 |
| Q |
219 |
ccttactggatatggttccattacctatcactggtgaagtacccttttgaaggagtgcttcagaatgagtttgatattaagccaccaaggtgcttcgtca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382835 |
ccttactggatatggttccattacctatcactggtgaagtacccttttgaaggagtgcttcagaatgagtttgatattaagccaccaaggtgcttcgtca |
40382736 |
T |
 |
| Q |
319 |
aagggattcagatgtttgataacactccgcttggtgatgtcc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382735 |
aagggattcagatgtttgataacactccgcttggtgatgtcc |
40382694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University