View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6969_high_6 (Length: 207)
Name: NF6969_high_6
Description: NF6969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6969_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 22 - 190
Target Start/End: Original strand, 44289059 - 44289227
Alignment:
| Q |
22 |
gtgccttaaaatttcagtcaaaaactattggttgctacaaaggtttccctgcggcacccaagagagaccgtgaggtgtttcaagcatttctaccttgggt |
121 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
44289059 |
gtgccttaaaatttcaatcaaaaactattggttgctacaaaggtttccccacggcgcccaagagagactgtgaggcgtttcaagcatttctaccttgggt |
44289158 |
T |
|
| Q |
122 |
gttcgccactatggcttccacaaggcgggacacatcgcctgcaaggcttttttatgttgcaaatttttc |
190 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| | ||||||||||||||| | ||||||||||||| |
|
|
| T |
44289159 |
gttcgccactatggcttccacgaggcgggacacattgtctgcaaggctttttttttttgcaaatttttc |
44289227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University