View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6969_low_8 (Length: 297)
Name: NF6969_low_8
Description: NF6969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6969_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 20 - 276
Target Start/End: Original strand, 48537220 - 48537473
Alignment:
| Q |
20 |
tcaggaacatgatcaggactcaatttaccctcttctttcaatgccaatgactcaaaataggctctttctttcgtcattggccatgattctcctatgcaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48537220 |
tcaggaacatgatcaggactcaatttaccctcttctttcaatgccaatgactcaaaataggctctttctttcgtcattggccatgattctcctatgcaac |
48537319 |
T |
|
| Q |
120 |
gaacatatggtaaagcctacaacaatgcaatgaaacccgttattaaaaattgaaaaaagaaggaatttttggaaggttatgtatgatgatgatacctgtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48537320 |
gaacatatggtaaagcctacaacaatgcaatgaaacccgttattaaaaattgaaaaaagaaggaatttttggaaggttatgt---atgatgatacctgtt |
48537416 |
T |
|
| Q |
220 |
tgatgacaaaagaaccgttggtgttggaaacgatgaagacaaaattaaggttgccat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48537417 |
tgatgacaaaagaaccgttggtgttggaaacgatgaagacaaaattaaggttgccat |
48537473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University