View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6970_high_6 (Length: 247)
Name: NF6970_high_6
Description: NF6970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6970_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 34800591 - 34800408
Alignment:
| Q |
11 |
gacatcattgtatgtctcccgctgtgctaatttaaaggcatcttctcccgaagttagaaaaggtgactatatctaattacctagaaatggagcgtttcct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34800591 |
gacatcattgtatgtctcccgctgtgctaatttagaggcatcttctcccgaagttagaaaaggtgactatatctaattacctagaaatggagcgtttcct |
34800492 |
T |
 |
| Q |
111 |
gaagggggtatgcctcctatctttatatcgctttatatcagggattgcgagaaactactgaggagatcatctccaacttcgatg |
194 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34800491 |
gaagggggtatgcctcctatctttagatcgctttatatcagggattgcgagaaactactgaggagatcatctctaacttcgatg |
34800408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University