View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6970_low_1 (Length: 491)
Name: NF6970_low_1
Description: NF6970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6970_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 2e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 41 - 134
Target Start/End: Complemental strand, 46642017 - 46641924
Alignment:
| Q |
41 |
ctgaactctcatgtgactggagagcagggatggacccacgtttgacatgatgtgggtctcgccctcgctacttaaaaaataataattttaaaat |
134 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46642017 |
ctgaactctcatgtgattggagagcagggacggacccacgtttgacatgatgtgggtctggccctcgctacttaaaaaataataattttaaaat |
46641924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 29966069 - 29966027
Alignment:
| Q |
15 |
attaatttttaatggacaagatttgactgaactctcatgtgac |
57 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
29966069 |
attaatttttaatggacaagatttcactggactctcgtgtgac |
29966027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 15 - 57
Target Start/End: Original strand, 30008729 - 30008771
Alignment:
| Q |
15 |
attaatttttaatggacaagatttgactgaactctcatgtgac |
57 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
30008729 |
attaatttttaatggacaagatttcactggactctcgtgtgac |
30008771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 6034571 - 6034628
Alignment:
| Q |
7 |
ccacatatattaatttttaatggacaagatttgactgaactctcatgtgactggagag |
64 |
Q |
| |
|
|||||| ||||||||||||| || ||||||| ||||||||||||||| |||| |||| |
|
|
| T |
6034571 |
ccacatgtattaatttttaactgataagattttactgaactctcatgtaactgaagag |
6034628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University