View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6970_low_7 (Length: 247)

Name: NF6970_low_7
Description: NF6970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6970_low_7
NF6970_low_7
[»] chr7 (1 HSPs)
chr7 (11-194)||(34800408-34800591)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 34800591 - 34800408
Alignment:
11 gacatcattgtatgtctcccgctgtgctaatttaaaggcatcttctcccgaagttagaaaaggtgactatatctaattacctagaaatggagcgtttcct 110  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34800591 gacatcattgtatgtctcccgctgtgctaatttagaggcatcttctcccgaagttagaaaaggtgactatatctaattacctagaaatggagcgtttcct 34800492  T
111 gaagggggtatgcctcctatctttatatcgctttatatcagggattgcgagaaactactgaggagatcatctccaacttcgatg 194  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
34800491 gaagggggtatgcctcctatctttagatcgctttatatcagggattgcgagaaactactgaggagatcatctctaacttcgatg 34800408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University