View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6971_high_16 (Length: 250)
Name: NF6971_high_16
Description: NF6971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6971_high_16 |
 | |
|
| [»] scaffold1250 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 36064766 - 36064522
Alignment:
| Q |
1 |
catacctgaaacaccccatggaagcccccacaaaagaatgcatatagtctaggattcccactctttcacaagtacaaaaatacttgcacaaatccatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064766 |
catacctgaaacaccccatggaagcccccacaaaagaatgcatatagtctaggattcccactctttcacaagtacaaaaatacttgcacaaatccatatt |
36064667 |
T |
|
| Q |
101 |
gcaattgcaaacatccttcaatagatttttcttatgaagttccatcatctgacgcttactaagatgacccagacgcatatgctacaatttggttgcagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36064666 |
gcaattgcaaacatccttcaatagatttttcttatgaagttccatcatctgacgcttattgagatgacccagacgcatatgctacagtttggttgcagga |
36064567 |
T |
|
| Q |
201 |
ttatcagacctaactaatgcaacatcaagaattggaacacgaaag |
245 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36064566 |
ttatcagacccaactaatgcaacatcaagaattggaacacgaaag |
36064522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1250 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold1250
Description:
Target: scaffold1250; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 76 - 187
Target Start/End: Original strand, 670 - 781
Alignment:
| Q |
76 |
aaaaatacttgcacaaatccatattgcaattgcaaacatccttcaatagatttttcttatgaagttccatcatctgacgcttactaagatgacccagacg |
175 |
Q |
| |
|
|||||||||||||||| || | |||||| |||||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||||||||| || |
|
|
| T |
670 |
aaaaatacttgcacaagtcaaacttgcaactgcaaacaaccttcaatagatttctcttatgaagttccatcatcccacgctcactaagatgacccaaaca |
769 |
T |
|
| Q |
176 |
catatgctacaa |
187 |
Q |
| |
|
||||||| |||| |
|
|
| T |
770 |
catatgccacaa |
781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University