View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6971_high_17 (Length: 250)
Name: NF6971_high_17
Description: NF6971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6971_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 9750299 - 9750097
Alignment:
| Q |
1 |
ccaatttttaaaggaagaccaaaagcttgccatcttcaaccaatagtagagaaactatcagcttggaaggcatcattgctttcaattgcaggaagagtac |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9750299 |
ccaatttttaaaggaataccaaaagcttgccatgttcaaccaatagcagagtaactatcggcttggaaggcatcattgctttcaattgcaggaagagtac |
9750200 |
T |
 |
| Q |
101 |
aagtgccaaagtctgtggttactagaatgctagctcatacattatctatttattcatggcttatttctctcttgaagggtacggaaaaatgcatcatcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||| |
|
|
| T |
9750199 |
aagtgccaaagtctgtggttactagaatgctagctcatacattatctatttattcatggcttatttctctcttgaagggcatgg-aaaatgcatcatcta |
9750101 |
T |
 |
| Q |
201 |
cttt |
204 |
Q |
| |
|
|||| |
|
|
| T |
9750100 |
cttt |
9750097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 140
Target Start/End: Complemental strand, 3564115 - 3564031
Alignment:
| Q |
56 |
tatcagcttggaaggcatcattgctttcaattgcaggaagagtacaagtgccaaagtctgtggttactagaatgctagctcatac |
140 |
Q |
| |
|
||||||| ||||| |||||||| | ||||||||||||||||||||| | |||||| || |||||||| ||||| ||||||| |
|
|
| T |
3564115 |
tatcagcctggaaagcatcattattgtcaattgcaggaagagtacaacttgtaaagtcagttgttactagcatgctgactcatac |
3564031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 98
Target Start/End: Complemental strand, 16920609 - 16920572
Alignment:
| Q |
61 |
gcttggaaggcatcattgctttcaattgcaggaagagt |
98 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
16920609 |
gcttggaaagcatcattgctttctattgcaggaagagt |
16920572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University