View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6971_high_20 (Length: 239)
Name: NF6971_high_20
Description: NF6971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6971_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 15702542 - 15702760
Alignment:
| Q |
14 |
gacatcagttcaagcttacaagacactggaaaagcagagagacaacctgttgagaacagatgaggttttgtggaggcagagaagtatggcagtatggttg |
113 |
Q |
| |
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
15702542 |
gacatcagttcaagcttacaaggcactagtaaagcagagagacaacctgttgagaacagataaggttttgtggaggcagaggagtagggcagtatggttg |
15702641 |
T |
 |
| Q |
114 |
aaggatggtgatagaaatacaaaaattttccatagcaaggccgaccagaggaggaaagcaaatgcaattaagaaactgaaagatgtcgacggagtgtggt |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15702642 |
aaggatggggatagaaatacaaaaattttccatagcaaggccgaccagaggaggaaaacaaatgcaattaagaaactgaaagatgtcttcggagtgtggt |
15702741 |
T |
 |
| Q |
214 |
ggaaaggtgatgtccatct |
232 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
15702742 |
ggaaaggtgatgaccatct |
15702760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 146
Target Start/End: Original strand, 23378347 - 23378379
Alignment:
| Q |
114 |
aaggatggtgatagaaatacaaaaattttccat |
146 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
23378347 |
aaggatggtgatagaaatacaaaaaatttccat |
23378379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University